Introduction

Perilla frutescens is a plant native to regions of Southeast Asia and has various uses such as an ingredient in natural products and food, and as a medicinal pigment (Seong et al. 2009). This plant has long been utilized as a raw material for oil extraction and is commonly known as “Dlggae” in Korea. Recently, consumption of perilla has increased significantly in Korea; more than 60% of the total unsaturated fatty acids (FAs) in perilla seeds comprises α-linolenic acid (Ichikawa 2006), an essential FA required for human growth and development, in addition to its known major role in preventing and treating blood vessel diseases (Shahidi and Miraliakbari 2005). Many flavonoids, sterols, terpenoids and phenolic acids have been extracted from seeds of Korean perilla and studied, with several studies reporting on the importance of flavonoids and phenolic compounds in relation to biological activity (Ozturk et al. 2010; Kim et al. 2019).

Seed priming technology using Ca(NO₃)₂, KNO₃, MgSO₄, NaNO₃, KCl, K₃PO₄, NH₄NO₃ and PEG 6000PEG (polyethylene glycol) involves pretreatment of seeds with different agents with varying concentration, duration, or temperature conditions, with the goal of improving seed production under given environmental conditions (Park et al. 2013). The success of priming is strongly involved in the hydration of the metabolism and process by which the seed absorbs a limited amount of water (Rahimi 2013). The complex network involved in seed metabolism is dependent on the agent used, duration, and temperature of the priming treatment, as well as vigor, dehydration, and storage conditions of primed seeds (Dezfuli et al. 2008). Seeds priming to enhance seed quality show increase pattern of germination rate which result in high levels of abiotic stress resistance. All these characteristics directly correlate to seed vigour, plant genotype and physiology controlled by multiple genetic and environmental factors (Jisha et al. 2013). Priming method is generally used to treat vegetables seeds such as carrot, celery, lettuce, pepper and tomato (Paparella et al. 2015). However, the establishment of seed priming techniques for medicinal crops is extremely limited. Therefore, it is necessary to improve the germination rate, shorten the number of days it takes to germinate, and establish optimal priming conditions for uniform seedling production in medicinal crops.

The effect of priming has been proven to improve seed germination and seedling growth using numerous chemical factors in various crops such as wheat, beans, sunflower, corn, and brassica (Cho et al. 2011a). For instance, the germination characteristics of corn seeds were improved after gibberellic acid (GA₃) or hydropriming treatment (Subedi and Ma 2005).

Gibberellic acid (GA₃) is essential for seed germination and flower development; for example, Arabidopsis exhibiting a deficiency in GA₃ content showed defects in seed germination and organ formation (Kim et al. 2014). In addition, loss-of-function studies have identified many genes involved in GA₃-induced seed germination (Cao et al. 2006). Genetic markers responding to GA₃ may be used to assess the specificity, which AtGA3ox1(GA4) was downregulated by GA₃ activity (Silverstone et al. 2001). Gene expression regulated by GA₃ during the germination process has also been studied, helping to explain the GA₃ response mechanism (Cao et al. 2006).

The purpose of this study was to establish an optimal germination system for Korean perilla through priming treatment, using various agents such as CaCl₂, Ca(NO₃)₂, NaCl, K₃PO₄, polyethylene glycol (PEG), and GA₃. In this report, we investigated the germination ratios resulting from the application of all the agents used in the seed priming treatments. Furthermore, this study aimed to reveal the genetic relationship between seed germination and GA₃ response, using gene expression data from the Perilla frutescens EST database generated in our previous study (Seong et al. 2015).

Materials and Methods

Priming treatments for Korean perilla seeds using various agents

All seeds used in this study were stored at 4°C and the priming conditions were tested on three sources of seed: Saeyeopsil, Okdong, and the 141 line. The agents used for priming treatment were CaCl₂, Ca(NO₃)₂, NaCl, K₃PO₄, PEG 6000 and GA₃. The concentrations of CaCl₂, Ca(NO₃)₂, NaCl and K₃PO₄ used were 100, 300 and 500 mM, respectively, and 0.6 and -0.9 MPa for PEG 6000. GA₃ was used at concentrations of 50, 100, 300 and 500 μM. Among priming techniques, osmotic priming and biopriming are the most widely used. Chemicals related to osmotic priming include CaCl₂, Ca(NO₃)₂, NaCl, K₃PO₄, and PEG 6000, and GA₃, a metabolite related to biopriming, was also selected and applied to the experiment. Treatment for concentrations of priming agents and seeds were preceded at 20°C for 3 days in a dark condition (Park et al. 2013).

Germination of primed Korean perilla seeds

Korean perilla seeds were sterilized with 70% ethanol for 5 min and 1% hydrogen peroxide for 5 min, and then dried naturally for 1 hour to achieve moisture balance of seeds. Next, 100 mL of priming solution and 5 g of sterilized perilla were placed in an Erlenmeyer flask. Priming treatment with CaCl₂, Ca(NO₃)₂, NaCl, K₃PO₄ and PEG 6000 was carried out for 3 days, at 20°C in the dark on a shaking incubator. Priming treatment with GA₃ was performed under dark condition at 20°C for 1 day.

Gene selection and primer design from the EST databases of Korean perilla

In our previous study, we analyzed and reported the metabolic classification for genes from the EST database contained in the Korean perilla cDNA library (Seong et al. 2015). As a result of Seong et al. (2015), nine genes related to seed germination were selected for analysis and are shown in Table 1, with numbers and the annotation of the EST database (Seong et al. 2015). To analyze the expression patterns of the 9 selected genes, RT-PCR were performed with 20-mer primers designed using the PICK primer program on the Bioneer homepage (https://www.bioneer.co.kr/index.php/).

RNA extraction from Korean perilla treated with GA₃

The prepared samples were placed in a pre-frozen pestle bowl with liquid nitrogen and ground to a fine powder using a stick. The ground sample was placed in a tube with TRIzol® Reagent (Thermo Fisher Scientific, USA), allowed to stand at room temperature for 5 min, with shaking, for thorough mixing. The samples were separated using a centrifuge at 13000 rpm and the supernatant transferred to a new tube, chloroform was added and left for 10 min, with shaking. The sample was again centrifuged at 13000 rpm and the supernatant transferred to a new tube. The supernatant was slowly mixed with 2‒3 times volume of isopropanol and stored overnight at -20°C. The following day, samples were thawed, centrifuged at 13000 rpm, and the supernatant discarded. The resulting pellets were washed with DEPC-treated 70% alcohol and dried. The total RNA was dissolved in DEPC-treated sterilized water and quantified on an agarose gel.

RT-PCR analysis

After cDNA synthesis from the quantified total RNA samples, RT-PCR was performed using primers (forward and reverse) for the Korean perilla actin gene. After confirming the expression level of the actin gene, the RT-PCR analysis was performed using primers for genes related to germination (Table 2). PCR conditions were as follows: initial denaturation at 94°C for 5 min; 28 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min and 1 min extension at 72°C, followed by an additional 10 min extension time at 72°C. Aliquots of 12 μL of the reacted samples were loaded and separated by electrophoresis on a 1% agarose gel. The reaction was done in triplicate for clarity of results. The band detected on the agarose gel was cloned into a pGEM T-easy vector, followed by sequencing, and homology was confirmed by aligning with sequences of the original genes.

Statistical analysis of germination rates

After treatment with the priming reagent, a germination test was carried out by in triplicate with 50 seeds for each treatment at 25°C for 10 days. To investigate the germination characteristics resulting from priming treatments, the average number of germinating seeds was determined after 15 days and was performed in triplicate. Statistical significance was analyzed using Duncan's Multiple Range Test (DMRT) using the IBM SPSS Statistics software (SPSS v. 23, International Business Machines Corp., Armonk, NY, USA). Statistical significance was determined at the 5% level.

Results

Improvement in germination rates by priming of Korean perilla seeds

In this study, the germination rates of Korean perilla were analyzed after treatment with six priming agents viz. CaCl₂, Ca(NO₃)₂, NaCl, K₃PO₄, PEG and GA₃. When seeds were primed with CaCl₂ at the concentrations of 100, 300 and 500 mM, the germination rates were 50.00 ± 1.63% for Saeyeopsil and 62.00 ± 1.63% for line 141 with 100 mM, and 68.66 ± 8.99% for Okdong with 300 mM. For priming with Ca(NO₃)₂, the germination rate was 56.00 ± 2.82% at 100 mM for Saeyeopsil and 72.66 ± 8.37 and 61.33 ± 6.79% at 300 mM for Okdong and line 141, respectively. The germination rate for all Korean perilla seeds primed with 100 mM NaCl ranged from 44.00 ± 3.26 to 53.33 ± 8.21%. However, NaCl treatment resulted in a lower germination rate compared to the control without priming treatment. The germination rate for the priming treatment with -0.96 MPa PEG was 58.00 ± 4.32% for Saeyeopsil and 64.00 ± 4.32% for Okdong, respectively. For the 141 collection, was higher value as 55.33 ± 2.49% in that of -0.6 MPa PEG. Priming with 0.1 mM GA₃ showed the best values among the priming treatment agents for all the Korean perilla seeds, presenting values ranging from 62.66 ± 1.88 to 70.66 ± 4.10%. However, no germination was observed with treatment at any concentration of K₃PO₄. Among various priming agents, 'Saeyeopsil' and 'Okdong' showed a high germination rate of 60~70% or more under GA₃ treatment, and '141 collection' showed a high germination rate of 70% or more under treatment with 100 mM CaCl₂ or 0.1 mM GA₃ (Table 3).

Gene expression by GA₃-priming treatment in Korean perilla

As GA₃proved to be the most effective at increasing germination rates in Korean perilla among all the priming agents used, it was selected as the priming agent for the analysis of the expression patterns of nine genes related to plant development. Gene expression patterns were compared between Korean perilla seeds treated or untreated with 0.1 mM GA₃ for 1‒5 d. We found no significant difference in the transcriptional levels of genes between GA₃ treated and untreated controls in Saeyeopsil. However, gene expression levels were higher in Okdong seeds treated for 1 d with GA₃ than in the water-only controls. The genes showing the greatest induction after GA₃ treatment for 1 d, were: protochlorophyllide reductase-like, magnesium chelatase subunit ChlI, heme-binding protein 2-like, glyceraldehyde 3-phosphate dehydrogenase A (GAPDH), Chlorophyll a-b binding protein 6 (LHCP), B2 protein, 2-Cys peroxiredoxin BAS1, and 21 kDa protein (Fig. 1).

Higher transcriptional levels were also observed for 141 collection seeds with GA₃ treatment for 1 d compared to controls. The highest expression levels were recorded for protochlorophyllide reductase-like, magnesium chelatase subunit ChlI, heme-binding protein 2-like, GAPDH, 2-Cys peroxiredoxin BAS1 and 21 kDa protein. Gene expression in Korean Table 1: Genes related to germination analyzed from the EST data of Korean perilla cDNA library

EST NO.	Annotations by blast results of EST
Perilla-1-1a_pTriplEx2-seq_E22	PREDICTED: 1-aminocyclopropane-1-carboxylate oxidase [Sesamum indicum]
Perilla-1-4a_pTriplEx2-seq_J14	PREDICTED: 21 kDa protein [Sesamum indicum]
Perilla-1-2a_pTriplEx2-seq_M18	PREDICTED: 2-Cys peroxiredoxin BAS1, chloroplastic-like [Sesamum indicum]
Perilla-2-1a_pTriplEx2-seq_I15	PREDICTED: B2 protein [Sesamum indicum]
Perilla-1-1a_pTriplEx2-seq_C22	PREDICTED: chlorophyll a-b binding protein 6, chloroplastic [Sesamum indicum]
Perilla-1-1a_pTriplEx2-seq_A24	PREDICTED: glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic [Sesamum indicum]
Perilla-3-2a_pTriplEx2-seq_G10	PREDICTED: heme-binding protein 2-like [Sesamum indicum]
Perilla-1-1a_pTriplEx2-seq_K12	PREDICTED: magnesium-chelatase subunit ChlI, chloroplastic-like [Sesamum indicum]
Perilla-2-2a_pTriplEx2-seq_C12	PREDICTED: protochlorophyllide reductase-like [Sesamum indicum]

Table 2: The primers designed to gene expression of EST selected from Korean perilla cDNA library

Actin gene and EST No.	Forward	Reverse
Pfactin	ACAGAGGCACCTCTCAACCC	ATCACGACCAGCAAGATCCA
Perilla-1-1a_pTriplEx2-seq_E22	GCGAAAACTGGGGTTTCTTC	AGGAAGAAGGTGCTCTCCCA
Perilla-1-4a_pTriplEx2-seq_J14	TGGAGGAGCTGTCTGACTCG	CGCCACATTCACAATCTTCC
Perilla-2-2a_pTriplEx2-seq_M18	CTAGTGACCGAGTGCCGAGA	GCTTGCAAGTGCTTCGTTTC
Perilla-2-1a_pTriplEx2-seq_I15	GTGCATGGCAACCTACAAGG	GATGCACGTAAGCACCCATC
Perilla-1-1a_pTriplEx2-seq_C22	CCGTCCTCTCTTCCTCCAAG	GTGGGTCGAATCCGAAATCT
Perilla-1-1a_pTriplEx2-seq_A24	TTGTGATCGAGGGAACTGGA	AGGAAGCGTTGCTGATGATG
Perilla-3-2a_pTriplEx2-seq_G10	TGATTTGGAGGATATCGGCA	CCTCTCTTTGTGAAAGGGGC
Perilla-1-1a_pTriplEx2-seq_K12	GAGCCAGAGGCCAGTTTACC	TCTCCCTCACTTCAGGACCC
Perilla-2-2a_pTriplEx2-seq_C12	CCCCTCTAACAAGGGAGCAG	GTTCGGGTACACTGACACGC

perilla seeds treated with GA₃ for 5 d showed a similar expression pattern compared to water treatment alone (Fig. 1). These results show that various genes are involved in seed germination metabolism during the early stages in Korean perilla seeds primed with GA₃.

Discussion

In general, priming agents should be free of toxicity and kept under constant water conditions for effective plant growth. Priming treatment agents inhibit cellular osmotic regulation, and high concentrations of ions can inhibit germination by destroying enzymes and membrane (Seo et al. 2009). The ion concentrations of the priming solution can affect germination and seedling appearance, as the agents penetrate into the seeds and may have toxic effects. Additionally, increases in ion accumulation of a priming solution can reduce the priming effect by interfering with metabolism (Seo et al. 2009).

In a previous report, the germination rate of Hippophae rhamnoides seeds was shown to 52.6% of 300 mM and 50.9% of 400 mM under CaCl₂priming treatment, respectively (Choi 2012). On the contrary, in a priming study of Sorbus alnifolia seed, CaCl₂ treatment resulted in a reduced germination rate compared to the control (Park et al. 2013). Ca(NO₃)₂ priming treatments for Saeyeopsil and Okdong produced higher germination rates than with CaCl₂. Ca(NO₃)₂ priming treatment was effective in tomato, but application resulted in a decrease when compared to the control in sesame seeds (Cho et al. 2011b). This indicates that the effect of priming treatment is crop-dependent. In this study, the germination rates with the NaCl priming treatment were lower compared to the non-treated controls, while K₃PO₄-treatment completely inhibited germination. Inorganic salts such as NaCl and K₃PO₄ are often used when salt priming is applied. Nitrogen-containing salts are more effective at improving germination rates than salts containing phosphoric acid (Bose et al. 2018). However, in this report, germination rates of Korean perilla seeds did not show any improvement with NaCl priming treatment.

PEG is known to play a role in regulating osmotic equilibrium (Ismail et al. 2005). The germination rates of Korean perilla seeds under PEG priming treatment increased compared to the controls, as was previously reported for germination rates and germinative power of Alnus sibirica (Park et al. 2013). In the case of Zanthoxylum piperitum seeds, GA₃ has been reported to increase the germination rate with increasing immersion time and concentration (Lim et al. 2015). The germination rate was significantly improved with GA₃ levels of 25 ppm, and the germination rate tended to increase with increasing GA₃concentrations in Lithospermum erythrorhizon seed (Kim et al. 2014). Among all the priming agents tested, the results indicate that GA₃ had the greatest effect, showing an increase of over 70% in the germination rates of Okdong and the 141 collection cultivars of Korean perilla.

In the past, many studies on seed priming with GA₃ and related genes in various plants such as vegetables or Arabidopsis have been reported, but these results are very limited in medicinal plants (Ogawa et al. 2003). Therefore, in our results, optimal germination conditions of Korean perilla were established during GA₃ priming, so we studied to analyze the correlation with genetic changes at the cellular level. DNA repair and antioxidant mechanisms are involved in minimization of growth inhibition for seeds during seedling development. The effects of the priming agent on DNA repair mechanisms are essential to optimize Table 3: Germination rate of three different cultivars depending on priming treatments in Perilla frutescens

Seed Treatment	Perilla frutescens
Seed Treatment		Saeyeopsil	Okdong	141 collection
Priming Agents	Concentrations	Germination rate (%)
Control		46.67 ± 12.85^bcdef	58.00 ± 5.29^de	54.67 ± 1.15^cdefg
CaCl₂	100 mM	50.00 ± 2.00^abcef	62.00 ± 3.46^cd	75.33 ± 3.06^a
	300 mM	32.67 ± 5.77^g	68.66 ± 11.02^abc	49.33 ± 3.06^fg
	500 mM	42.00 ± 2.00^efg	56.67 ± 4.62^de	45.33 ± 6.43^g
Ca (Na₃)₂	100 mM	56.00 ± 3.46^abcd	69.33 ± 8.33^abc	59.33 ± 7.02^cdef
	300 mM	54.00 ± 6.93^abce	72.67 ± 10.26^ab	61.33 ± 8.32^bcde
	500 mM	43.33 ± 12.22^defg	60.67 ± 3.06^cd	48.67 ± 2.31^g
NaCl	100 mM	44.00 ± 4.00^cdefg	55.33 ± 5.03^de	53.33 ± 10.07^defg
	300 mM	40.00 ± 4.00^fg	50.00 ± 6.00^e	48.67 ± 7.02^g
	500 mM	34.00 ± 3.46^g	50.00 ± 2.00^e	33.33 ± 6.10^h
K₃PO₄	100 mM	ND	ND	ND
	300 mM	ND	ND	ND
	500 mM	ND	ND	ND
PEG	-0.6 Mpa	48.67 ± 16.65^bcdef	62.00 ± 10.39^cd	55.33 ± 3.06^cdefg
PEG	-0.9 Mpa	58.00 ± 5.29^ab	64.00 ± 5.29^bcd	51.33 ± 4.16^efg
GA₃	0.05 mM	62.00 ± 2.00^a	74.67 ± 2.31^a	59.33 ± 9.02^cdef
	0.1 mM	62.67 ± 2.31^a	78.67 ± 4.16^a	70.67 ± 5.03^ab
	0.3 mM	54.00 ± 7.21^abce	74.00 ± 2.00^ab	63.33 ± 5.03^bcd
	0.5 mM	56.66 ± 5.03^abc	75.33 ± 1.15^a	64.66 ± 4.16^bc

Fig. 1: Expression patterns of genes related to germination from EST analysis data of Korean perilla after seed priming with water and GA₃

priming methods (Balestrazzi et al. 2015). Therefore, the induced genes according to the establishment of priming optimization during seed germination of Korean perilla were identified. It is expected that these genes can be used as biomarkers to create a cultivation environment that increase the germination rate of Korean perilla by investigating genes induced during seed germination using GA₃.

In peas, protochlorophyllide reductase has been shown to play a post-transcriptional regulatory role in protein elongation and conversion. Protein expression patterns differ between monocots and dicots, but protochlorophyllide reductase is present in higher plants (Cahoon and Timko 2000). Magnesium-chelatase subunit ChII is known to be active in plant-cell interactions, chelating magnesium on protoporphyrin IX and mediating plastid-to nucleus retrograde signaling (Papenbrock et al. 2000; Nott et al. 2006). HBP is induced by oxidative stress and is involved in various functions of the protein (Lee et al. 2012). GAPDH catalyzes the conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate and has two isoforms, GAPCp1 and GAPCp2, both of which are important for the plastidial glycolytic pathway in plant primary metabolism (Munoz-Bertomeu et al. 2009). The LHCP gene shows an expression pattern specific to chloroplast-containing tissue, and mRNA expression can be determined by its associated factors (Wang and Grimm 2021). The 2-Cys peroxiredoxin BAS1 gene has antioxidant properties that regulate cellular redox states and is associated with the soluble chloroplast fraction function of mesophyll protoplasts in higher plants (Cerveau et al. 2016).

Conclusion

In this study, genes from the Korean perilla selected from the EST database that were induced by GA₃treatment are related to oxidative stress, plastidial metabolism, tissue specificity, redox reactions, and chloroplast function in plant cells. It was found that the method to increase the germination rate of Korean perilla is the optimal concentration treatment of GA₃. Under this optimal condition, these marker genes such as protochlorophyllide reductase-like, magnesium-chelatase subunit ChlI, heme-binding protein 2-like, glyceraldehyde 3-phosphate dehydrogenase A, and Chlorophyll Since ab binding protein 6, B2 protein, 2-Cys peroxiredoxin BAS1, and 21 kDa protein genes are induced and this pattern is thought to be involved in GA₃ priming. We suggest that these genes induce substances related to the initial stages of germination metabolism of Korean perilla seeds under GA₃ priming, thus improving the germination rate. In the future, we propose studying the functional relationship between these genes and the germination of Korean perilla seeds.

Acknowledgements

This study was supported by the Bioherb Research Institute, Kangwon National University, Republic of Korea.

Author Contributions

ES Seong and BJ Kang performed experiment design and writing of manuscript. CYY supervised the experi ment. JH Yoo, JG Lee and NY Kim performed editing of manuscript.

Conflicts of Interest

The authors declare that they have no confict of interest.

Data Availability

Data presented in this study are available with the authors.

Ethics Approval

There are no researches conducted on animals or human.

References

Balestrazzi A, M Dona, A Macovei, ME Sabatini, A Pagano, D Carbonera (2015). DNA repair and telomere maintenance during seed imbibition: Correlation of transcriptional patterns. Telomere Telomerase 2; Article e495

Bose B, M Kumar, RK Singhal, S Mondal (2018). Impact of seed priming on the modulation of physico-chemical and molecular processes during germination, growth, and development of crops. In: Advances in Seed Priming, pp:23‒40. Rakshit A, H Singh (Eds). Springer, Singapore

Cahoon AB, MP Timko (2000). Yellow-in-the-dark mutants of Chlamydomonas lack the CHLL Subunit of light-independent protochlorophyllide reductase. Plant Cell 12:559‒568

Cao D, H Cheng, W Wu, HM Soo, J Peng (2006). Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. Plant Physiol 142:509‒525

Cerveau D, A Kraut, HU Stotz, MJ Mueller, Y Coute, P Rey (2016). Characterization of the Arabidopsis thaliana 2-Cys peroxiredoxin interactome. Plant Sci 252:30‒41

Cho SK, KB Shim, YJ Oh, SB Lee (2011a). Effect of priming conditions on enhancing germination of sesame (Sesamum indicum L.) Seed. J Kor Soc Intl Agric 23:395‒401

Cho SK, KB Shim, YJ Oh, SB Lee, JJ Lee, KM Cho, TI Park, OK Han, KJ Kim (2011b). Effect of priming conditions on enhancing germination of sesame (Sesamum indicum L.) seed. Kor J Intl Agric 23:395‒401

Choi CH (2012). effect of temperature and various pre-treatments on germination of Hippophae rhamnoides seeds. Kor J Plant Res 25:132‒141

Dezfuli PM, F Sharif-zadeh, M Janmohammadi (2008). Influence of priming techniques on seed germination behavior of maize inbred lines (Zea mays L.). ARPN J Agric Biol Sci 3:22‒25

Ichikawa K (2006). Nutritional properties and utilization of perilla seed oil (in Japanese). J Oleo Sci 6:257‒264

Ismail AI, MM El-Araby, AZA Hegazi, SMA Moustafa (2005). Optimization of priming benefits in tomato (Lycopersicon esculentum M.) and changes in some osmolytes the hydration phase. Asia J Plant Sci 4:691‒701

Jisha KC, K Vijayakumari, JT Puthur (2013). Seed priming for abiotic stress tolerance: An overview. Acta Physiol Plantarum 35:1381–1396

Kim DH, BJ Ahn, HJ An, YS Ahn, CG Park, SW Cha, BH Song (2014). Studies on seed germination characteristics and patterns of protein expression of Lithospermum erythrorhizon by plant growth regulators and seed primings. Kor Med Crop Sci 22:435‒441

Kim HW, DS Kim, NY Sung, IJ Han, BS Lee, SY Park, J Eom, JY Suh, J Park, A Yu, JS Kim (2019). Development of functional cosmetic material using a combination of Hippophae rhamnoides fruit, Rubus fruticosus leaf and Perillae folium leaf extracts. Asian J Beauty Cosmetol 17:477‒488

Lee HJ, N Mochizuki, T Masuda, TJ Buckhout (2012). Disrupting the bimolecular binding of the haem-binding protein 5 (AtHBP5) to haem oxygenase 1 (HY1) leads to oxidative stress in Arabidopsis. J Exp Bot 63:695‒709

Lim HI, GN Kim, KH Jang, WG Park (2015). Effect of wet cold and gibberellin treatments on germination of dwarf stone pine seeds. Kor J Plant Res 28:253‒258

Munoz-Bertomeu J, B Cadcales-Minana, JM Mulet, E Baroja-Ferna´ndez, J Pozueta-Romero, JM Kuhn, J Segura, R Ros (2009). Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis. Plant Physiol 151:541‒558

Nott A, HS Jung, S Koussevitzky, J Chory (2006). Plastid-to-nucleus retrograde signaling. Annu Rev Plant Biol 57:739‒759

Ogawa M, A Hanada, Y Yamauchi, A Kuwahara, Y Kamiya, S Yamaguchi (2003). Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15:1591‒1604

Ozturk M, ME Duru, B Ince, M Harmandar, G Topcu (2010). A new rapid spectrophotometric method to determine the rosmarinic acid level in plant extracts. Food Chem 123:1352‒1356

Paparella S, SS Arau, G Rossi, M Wijayasinghe, D Carbonera, A Balestrazzi (2015). Seed priming: State of the art and new perspectives. Plant Cell Rep 34:1281‒1293

Papenbrock J, HP Peter-Mock, R Tanaka, E Kruse, B Grimm (2000). Role of magnesium chelatase activity in the early steps of the tetrapyrrole biosynthetic pathway. Plant Physiol 122:1161‒1169

Park HI, HS Shim, LN Choi, SH Han, JG Lee, CY Yu, JD Lim (2013). Effect of priming and seed pellet technique for improved germination and growth in Fraxinus rhynchophylla and Alnus sibirica. Kor J Med Crop Sci 21:7‒19

Rahimi A (2013). Seed priming improves the germination performance of cumin (Cuminum syminum L.) under temperature and water stress. Indus Crops Prod 42:454‒460

Seo BS, CH Choi, WJ Park (2009). Effect of priming treatments on seed germination and seedling growth of Sorbus alnifolia. Kor J Plant Res 22:5‒12

Seong ES, JH Yoo, JH Choi, CH Kim, MR Jeon, BJ Kang, JG Lee, SK Choi, BK Ghimire, CY Yu (2015). Expressed sequence tags analysis and design of simple sequence repeats markers from a full-length cDNA Library in Perilla frutescens (L.). Intl J Genomics 2015; Article 679548

Seong ES, EW Seo, HS Kim, K Heo, JK Lee, IM Chung, BK Ghimire, MJ Kim, JD Lim, CY Yu (2009). Molecular characterization of the Perilla frutescens limonene gene (PFLS) by agroinfiltration into Nicotiana benthamiana. Kor J Med Crop Sci 17:33‒38

Shahidi F, H Miraliakbari (2005). Omega-3 fatty acids in health and disease. Part 2. health effects of omega-3 fatty acids in autoimmune diseases, mental health, and gene expression. J Med Food 8:133‒148

Silverstone AL, HS Jung, A Dill, H Kawaide, Y Kamiya, TP Sun (2001). Repressing a repressor: Gibberellin-induced rapid reduction of the RGA protein in Arabidopsis. Plant Cell 13:1555‒1565

Subedi KD, BL Ma (2005). Seed priming does not improve corn Yield in a humid temperate environment. Agron J 97:211‒218

Wang P, B Grimm (2021). Connecting chlorophyll metabolism with accumulation of the photosynthetic apparatus. Trends Plant Sci 26:484–495